Assignment of porcine serotonin receptor subtype 2 alpha and endothelin-B receptor to chromosome 11 by linkage analysis.

نویسندگان

  • H S Sun
  • L Wang
  • M F Rothschild
  • C K Tuggle
چکیده

Genus and Species. Sus scrofa. Locus. Pig serotonin receptor subtype 2 alpha ( HTR2A) and pig endothelin-B receptor ( EDNRB) . Source and Description of Primers. Heterologous primers for EDNRB were obtained from Leslie Lyons through the CATS project (Lyons et al., 1997) and primers for HTR2A were designed from highly conserved human (M86841) and mouse sequences (X72222). Primers ( EDNRB forward: 5¢AATTGTTTTAATTTGGGTGGTCTC3¢ and EDNRB reverse: 5¢-AGCCACCAGTCTTTAGCTGTC-3¢; HTR2A forward: 5¢-CCCTAGAGAAAAAGCTGCAGA-3¢ and HTR2A reverse: 5¢GACACGGGCATGACAAGGA-3¢) were used to amplify pig homologous fragments by standard PCR. Pig genomic fragments amplified with heterologous primers were sequenced to confirm homology. An 81% similarity over 125 bp was found in the exon 3 region of the EDNRB gene between human and the new pig sequence-tagged sites ( STS) . A 100% sequence similarity was found for 115 bases of the exon 1 region of HTR2A gene between our STS and a pig HTR2A cDNA sequence (accession no. S78208). Pig-specific primers were designed from the pig STS obtained in this study ( HTR2A forward: 5¢CCCTAGAGAAAAAGCTG CAGA-3¢ and HTR2A reverse: 5¢-GCAGAGGCCACCGGTA-3¢) to increase the PCR efficiency.

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Renin-angiotensin system and unilateral ureteral obstruction

Unilateral ureteral obstruction (UUO) is a clinical scenario that leads to obstructive nephropathy. UUO alters the expression of many mediators in the ipsilateral kidney. Renin-angiotensin system (RAS) is involved in UUO. Angiotensin II (Ang II) and angiotensin 1-7 (Ang 1-7) as the main arms of RAS influence kidney function which may alter by UUO. Ang II via Ang II receptor subtypes I (AT1R) ...

متن کامل

P-238: Lack of Association of Estrogen Receptor Polymorphisms with Male Infertility

Background: Estrogen is recognized as one of the significant regulator of spermatogenesis. Estrogens are synthesized in the male reproductive system (sertoli and leydig cells). Estrogen function is mediated by estrogen receptors (ER-α or ER-β). Some studies have suggested an association between single nucleotide polymorphisms (SNPs) rs2234693 (ESR1 pvuII C>T), rs1801132 (ESR1 325 C->G) of ERα g...

متن کامل

An updated linkage and comparative map of porcine chromosome 18.

Swine chromosome 18 (SSC18) has the poorest marker density in the USDA-MARC porcine linkage map. In order to increase the marker density, seven genes from human chromosome 7 (HSA7) expected to map to SSC18 were selected for marker development. The genes selected were: growth hormone releasing hormone receptor (GHRHR), GLI-Kruppel family member (GLI3), leptin (LEP), capping protein muscle Z-line...

متن کامل

Immunohistochemical Eexpression of Endothelin A Receptor in Dysplastic Oral Mucosa

Background: Recent researches have provided evidences of the importance of endothelin axis in carcinogenesis. According to our knowledge, no data exists about endothelin A receptor (ETA) expression in dysplastic oral mucosa (DOM). Therefore, the aim of the present study was to evaluate immunohistochemical expression of ETA in DOM. Methods:</strong...

متن کامل

Modeling and interactions analysis of the novel antagonist agent flibanserin with 5-hydroxytryptamine 2A (5-HT2A) serotonin receptor as a HSDD treatment in premenopausal women

Flibanserin is a novel antagonist small molecule to treat the hypoactive sexual desire disorder (HSDD) in the premenopausal women. The present article is related to the structural and electronic properties study and docking analysis of the title compound with 5-hydroxytryptamine 2A (5-HT2A) serotonin receptor. To access these aims, the molecular structure of the said compound was optimized usin...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

عنوان ژورنال:
  • Journal of animal science

دوره 77 3  شماره 

صفحات  -

تاریخ انتشار 1999